i e coli i strain w3110 Search Results


96
ATCC control include escherichia coli w3110
Control Include Escherichia Coli W3110, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/i+e+coli+i+strain+w3110/Escherichia+coli+W3110/us07306933-109-10-15
Average 96 stars, based on 1 article reviews
control include escherichia coli w3110 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

99
ATCC properties
Properties, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/i+e+coli+i+strain+w3110/Escherichia+coli+(Migula)+Castellani+and+Chalmers/pmc04551174-88-15-16
Average 99 stars, based on 1 article reviews
properties - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

94
ATCC i e coli i w3110 strain 27c7
I E Coli I W3110 Strain 27c7, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/i+e+coli+i+strain+w3110/Escherichia+Coli/us09499596-694-50-55
Average 94 stars, based on 1 article reviews
i e coli i w3110 strain 27c7 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

95
ATCC rrnd rrne 1 rph 1 atcc 27325 plasmids pug6 deletion plasmid
Strains, plasmids, and cloning primers used in this study
Rrnd Rrne 1 Rph 1 Atcc 27325 Plasmids Pug6 Deletion Plasmid, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/i+e+coli+i+strain+w3110/Escherichia+Coli%3B+W3110/pmc02663214-108-116-119
Average 95 stars, based on 1 article reviews
rrnd rrne 1 rph 1 atcc 27325 plasmids pug6 deletion plasmid - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

96
ATCC strain w3110
Strains, plasmids, and cloning primers used in this study
Strain W3110, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/i+e+coli+i+strain+w3110/Escherichia+coli+(Migula)+Castellani+and+Chalmers/pmc00524897-101-0-2
Average 96 stars, based on 1 article reviews
strain w3110 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

93
ATCC w3110 strain
E. coli ATCC 14155 carries an AI-2- and sugar-inducible prophage. (A) Optical densities of E. coli ATCC 14155 cultures (each dot represents individual culture) grown alone or in a 1:1 mixture with E. coli <t>W3110</t> or W3110 Δ luxS bacteria or with 10 μl E. coli W3110 wild-type bacteria or Δ luxS cell-free supernatants. (B) Transmission electron microscopy (TEM) of phage particles found in E. coli ATCC 15144 lysates. Scale bar, 200 nm. Note that the different levels of brightness in the four quadrants of the image represent an artifact of the TEM imaging system. (C) Prophage induction in E. coli ATCC 14155 by AI-2 and sugar influx. Single dots represent individual cultures. glu, glucose; 2-DG, 2-deoxy- d -glucose. Means of results of a minimum of 12 independent replicates are shown; error bars represent standard deviations. P values were calculated using the Mann-Whitney test (*** * , P < 0.0001; ** * , P < 0.0005; *, P < 0.05; ns, not significant).
W3110 Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/i+e+coli+i+strain+w3110/Escherichia+coli+(Migula)+Castellani+and+Chalmers/pmc06737242-76-10-14
Average 93 stars, based on 1 article reviews
w3110 strain - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
ATCC i e coli i k 12 strain
E. coli ATCC 14155 carries an AI-2- and sugar-inducible prophage. (A) Optical densities of E. coli ATCC 14155 cultures (each dot represents individual culture) grown alone or in a 1:1 mixture with E. coli <t>W3110</t> or W3110 Δ luxS bacteria or with 10 μl E. coli W3110 wild-type bacteria or Δ luxS cell-free supernatants. (B) Transmission electron microscopy (TEM) of phage particles found in E. coli ATCC 15144 lysates. Scale bar, 200 nm. Note that the different levels of brightness in the four quadrants of the image represent an artifact of the TEM imaging system. (C) Prophage induction in E. coli ATCC 14155 by AI-2 and sugar influx. Single dots represent individual cultures. glu, glucose; 2-DG, 2-deoxy- d -glucose. Means of results of a minimum of 12 independent replicates are shown; error bars represent standard deviations. P values were calculated using the Mann-Whitney test (*** * , P < 0.0001; ** * , P < 0.0005; *, P < 0.05; ns, not significant).
I E Coli I K 12 Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/i+e+coli+i+strain+w3110/Escherichia+Coli%3BStrain+C600/us08853150-552-9-19
Average 93 stars, based on 1 article reviews
i e coli i k 12 strain - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

96
ATCC host strain atcc pta 3132
E. coli ATCC 14155 carries an AI-2- and sugar-inducible prophage. (A) Optical densities of E. coli ATCC 14155 cultures (each dot represents individual culture) grown alone or in a 1:1 mixture with E. coli <t>W3110</t> or W3110 Δ luxS bacteria or with 10 μl E. coli W3110 wild-type bacteria or Δ luxS cell-free supernatants. (B) Transmission electron microscopy (TEM) of phage particles found in E. coli ATCC 15144 lysates. Scale bar, 200 nm. Note that the different levels of brightness in the four quadrants of the image represent an artifact of the TEM imaging system. (C) Prophage induction in E. coli ATCC 14155 by AI-2 and sugar influx. Single dots represent individual cultures. glu, glucose; 2-DG, 2-deoxy- d -glucose. Means of results of a minimum of 12 independent replicates are shown; error bars represent standard deviations. P values were calculated using the Mann-Whitney test (*** * , P < 0.0001; ** * , P < 0.0005; *, P < 0.05; ns, not significant).
Host Strain Atcc Pta 3132, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/i+e+coli+i+strain+w3110/Hybrid+corn+(maize)+seed+C21FABB+PDF%2C+34T38/us07785830-77-17-19
Average 96 stars, based on 1 article reviews
host strain atcc pta 3132 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

99
ATCC escherichia coli
General informations and report on evidence of biological activities and chemistry of the studied plants
Escherichia Coli, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/i+e+coli+i+strain+w3110/Escherichia+coli/pmc04855409-137-23-18
Average 99 stars, based on 1 article reviews
escherichia coli - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

96
ATCC plaque positive w3110
General informations and report on evidence of biological activities and chemistry of the studied plants
Plaque Positive W3110, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/i+e+coli+i+strain+w3110/Escherichia+coli+(Migula)+Castellani+and+Chalmers/pmc01907122-402-20-25
Average 96 stars, based on 1 article reviews
plaque positive w3110 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

97
ATCC commensal strains
General informations and report on evidence of biological activities and chemistry of the studied plants
Commensal Strains, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/i+e+coli+i+strain+w3110/Escherichia+coli/pmc03302597-211-11-13
Average 97 stars, based on 1 article reviews
commensal strains - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

Image Search Results


Strains, plasmids, and cloning primers used in this study

Journal:

Article Title: Engineering a Synthetic Dual-Organism System for Hydrogen Production

doi: 10.1128/AEM.02009-08

Figure Lengend Snippet: Strains, plasmids, and cloning primers used in this study

Article Snippet: Strain, plasmid or primer Genotype, description, or sequence Source or reference Strains S. cerevisiae PSY580a (wild type) Mat a ura3 Δ 52 trp1 Δ 63 leu2 Δ 1 GAL2 + 47 PSY3643 PSY580a Δ fdh1 ::loxP- kanMX -loxP This work PSY3644 PSY580a Δ fdh1 ::loxP This work PSY3645 PSY580a Δ fdh1 ::loxP Δ fdh2 ::loxP- kanMX -loxP This work PSY3646 (Δ FDH1 Δ FDH2 ) PSY580a Δ fdh1 ::loxP Δ fdh2 ::loxP This work PSY3647 PSY3646 LEU2 :: pflB This work PSY3648 (PFL) PSY3646 LEU2 :: pflB TRP1 :: pflA This work PSY3649 (PFL and AdhE) PSY3646 LEU2 :: pflB TRP1 :: pflA URA3 :: AdhE This work E. coli W3110 F − λ − IN( rrnD-rrnE )1 rph-1 ATCC 27325 Plasmids pUG6 Deletion plasmid; kanMX marker 15 pSH65 Cre-expressing plasmid; phleomycin gene marker 15 V0120-BB Empty biobrick vector 29 P0511-BB pGal1 2 L0101-BB Adh1 terminator 2 PPS3160-BB V0120; pflB This work PPS3161-BB V0120; pflA This work PPS3162-BB V0120; adhE This work PPS3163-BB V0120; pGal1- pflB -Adh1_Term This work PPS3164-BB V0120; pGal1- pflA -Adh1_Term This work PPS3165-BB V0120; pGal1- adhE -Adh1_Term This work pRS304 S. cerevisiae integration vector; trp1 marker 38 pRS305 S. cerevisiae integration vector; leu2 marker 38 PRS306 S. cerevisiae integration vector; ura3 marker 38 PPS3166 pRS304; pGal1- pflA -Adh1_Term This work PPS3167 pRS305; pGal1- pflB -Adh1_Term This work PPS3168 pRS306; pGal1- adhE -Adh1_Term This work Cloning primers FDH1/2-hom1 ATGTCGAAGGGAAAGGTTTTGCTGGTTCTTTACGAAGGTGCAGCTGAAGCTTCGTACGC This work FDH1/2-hom2 TTATTTCTTCTGTCCATAAGCTCTGGTGGCATAAGAACCAGCATAGGCCACTAGTGGATCTG This work 5′ pflB CCTTGAATTCGCGGCCGCATCTAGAATGTCCGAGCTTAATGAAAAG This work 3′ pflB AAGGACTAGTTTACATAGATTGAGTGAAGGTACGAGTAATAACGTCCTGCTG This work 5′ pflA CCTTGAATTCGCGGCCGCATCTAGAATGTCAGTTATTGGTCGCAT This work 3′ pflA AAGGACTAGTTTAGAACATTACCTTATGACCGTACTGCTCAAGAATGCC This work 5′ adhE CCTTGAATTCGCGGCCGCATCTAGAATGGCTGTTACTAATGTCG This work 3′ adhE AAGGACTAGTTTAAGCGGATTTTTTCGCTTTTTTCTCAGCTTTAGCCGG This work Open in a separate window Strains, plasmids, and cloning primers used in this study. . Construction of S. cerevisiae strains.

Techniques: Cloning, Plasmid Preparation, Sequencing, Marker

E. coli ATCC 14155 carries an AI-2- and sugar-inducible prophage. (A) Optical densities of E. coli ATCC 14155 cultures (each dot represents individual culture) grown alone or in a 1:1 mixture with E. coli W3110 or W3110 Δ luxS bacteria or with 10 μl E. coli W3110 wild-type bacteria or Δ luxS cell-free supernatants. (B) Transmission electron microscopy (TEM) of phage particles found in E. coli ATCC 15144 lysates. Scale bar, 200 nm. Note that the different levels of brightness in the four quadrants of the image represent an artifact of the TEM imaging system. (C) Prophage induction in E. coli ATCC 14155 by AI-2 and sugar influx. Single dots represent individual cultures. glu, glucose; 2-DG, 2-deoxy- d -glucose. Means of results of a minimum of 12 independent replicates are shown; error bars represent standard deviations. P values were calculated using the Mann-Whitney test (*** * , P < 0.0001; ** * , P < 0.0005; *, P < 0.05; ns, not significant).

Journal: mBio

Article Title: Quorum Sensing and Metabolic State of the Host Control Lysogeny-Lysis Switch of Bacteriophage T1

doi: 10.1128/mBio.01884-19

Figure Lengend Snippet: E. coli ATCC 14155 carries an AI-2- and sugar-inducible prophage. (A) Optical densities of E. coli ATCC 14155 cultures (each dot represents individual culture) grown alone or in a 1:1 mixture with E. coli W3110 or W3110 Δ luxS bacteria or with 10 μl E. coli W3110 wild-type bacteria or Δ luxS cell-free supernatants. (B) Transmission electron microscopy (TEM) of phage particles found in E. coli ATCC 15144 lysates. Scale bar, 200 nm. Note that the different levels of brightness in the four quadrants of the image represent an artifact of the TEM imaging system. (C) Prophage induction in E. coli ATCC 14155 by AI-2 and sugar influx. Single dots represent individual cultures. glu, glucose; 2-DG, 2-deoxy- d -glucose. Means of results of a minimum of 12 independent replicates are shown; error bars represent standard deviations. P values were calculated using the Mann-Whitney test (*** * , P < 0.0001; ** * , P < 0.0005; *, P < 0.05; ns, not significant).

Article Snippet: However, a modestly higher level of AI-2 produced by the W3110 strain in the ATCC 15144:W3110 mixed cultures or addition of 5 μM DPD/AI-2 to growing ATCC 15144 cultures was already enough to activate the lysogeny-lysis switch and cell lysis ( and ).

Techniques: Bacteria, Transmission Assay, Electron Microscopy, Imaging, MANN-WHITNEY

T1 phage-encoded transcription regulator Pir (Orf23) controls AI-2- and sugar-dependent prophage induction. (A) Pir is a functional transcription regulator. Activities of hol , dam , pir , and recE promoters controlling gfp expression (measured by flow cytometry and expressed in arbitrary units [AU]) in the absence ( pir − ) or presence ( pir + ) of plasmid-harbored pir were measured in E. coli W3110 by flow cytometry. (B) pir and hol were upregulated during AI-2- and glucose-mediated prophage induction. Activities of pir and hol promoters were measured at the onset of visible cell lysis by flow cytometry. (C) Activities of pir and hol promoters in a phage-free background strain, BL21(DE3), were measured by flow cytometry 2 h after addition of 30 μM DPD/AI-2 or 0.2% glucose. (D) Effect of CRISPRi-mediated inhibition of pir expression on lysis of E. coli ATCC 15144. Single dots represent optical densities of individual E. coli cultures (CRISPRi − aTc − ) carrying a CRISPRi system without (CRISPRi + aTc − ) or with (CRISPRi + aTc + ) induction of dCas9 protein expression, measured 2 h after addition of 10 μl E. coli W3110 cell-free supernatant. aTc, anhydrotetracycline. (E) hol promoter activity measured by flow cytometry in the setup described in the panel D legend. Single dots represent hol promoter activities in individual cultures. Means of results from a minimum of three independent replicates are shown; error bars represent standard deviations. P values were calculated using the Mann-Whitney test (*** * , P < 0.0001; ** * , P < 0.0005; * * , P < 0.005; ns, not significant).

Journal: mBio

Article Title: Quorum Sensing and Metabolic State of the Host Control Lysogeny-Lysis Switch of Bacteriophage T1

doi: 10.1128/mBio.01884-19

Figure Lengend Snippet: T1 phage-encoded transcription regulator Pir (Orf23) controls AI-2- and sugar-dependent prophage induction. (A) Pir is a functional transcription regulator. Activities of hol , dam , pir , and recE promoters controlling gfp expression (measured by flow cytometry and expressed in arbitrary units [AU]) in the absence ( pir − ) or presence ( pir + ) of plasmid-harbored pir were measured in E. coli W3110 by flow cytometry. (B) pir and hol were upregulated during AI-2- and glucose-mediated prophage induction. Activities of pir and hol promoters were measured at the onset of visible cell lysis by flow cytometry. (C) Activities of pir and hol promoters in a phage-free background strain, BL21(DE3), were measured by flow cytometry 2 h after addition of 30 μM DPD/AI-2 or 0.2% glucose. (D) Effect of CRISPRi-mediated inhibition of pir expression on lysis of E. coli ATCC 15144. Single dots represent optical densities of individual E. coli cultures (CRISPRi − aTc − ) carrying a CRISPRi system without (CRISPRi + aTc − ) or with (CRISPRi + aTc + ) induction of dCas9 protein expression, measured 2 h after addition of 10 μl E. coli W3110 cell-free supernatant. aTc, anhydrotetracycline. (E) hol promoter activity measured by flow cytometry in the setup described in the panel D legend. Single dots represent hol promoter activities in individual cultures. Means of results from a minimum of three independent replicates are shown; error bars represent standard deviations. P values were calculated using the Mann-Whitney test (*** * , P < 0.0001; ** * , P < 0.0005; * * , P < 0.005; ns, not significant).

Article Snippet: However, a modestly higher level of AI-2 produced by the W3110 strain in the ATCC 15144:W3110 mixed cultures or addition of 5 μM DPD/AI-2 to growing ATCC 15144 cultures was already enough to activate the lysogeny-lysis switch and cell lysis ( and ).

Techniques: Functional Assay, Expressing, Flow Cytometry, Plasmid Preparation, Lysis, Inhibition, Activity Assay, MANN-WHITNEY

List of bacterial strains and plasmids used in this study <xref ref-type= a " width="100%" height="100%">

Journal: mBio

Article Title: Quorum Sensing and Metabolic State of the Host Control Lysogeny-Lysis Switch of Bacteriophage T1

doi: 10.1128/mBio.01884-19

Figure Lengend Snippet: List of bacterial strains and plasmids used in this study a

Article Snippet: However, a modestly higher level of AI-2 produced by the W3110 strain in the ATCC 15144:W3110 mixed cultures or addition of 5 μM DPD/AI-2 to growing ATCC 15144 cultures was already enough to activate the lysogeny-lysis switch and cell lysis ( and ).

Techniques: Plasmid Preparation, Functional Assay, Expressing, Control, Knockdown

General informations and report on evidence of biological activities and chemistry of the studied plants

Journal: BMC Complementary and Alternative Medicine

Article Title: Antibacterial and antibiotic-modulation activity of six Cameroonian medicinal plants against Gram-negative multi-drug resistant phenotypes

doi: 10.1186/s12906-016-1105-1

Figure Lengend Snippet: General informations and report on evidence of biological activities and chemistry of the studied plants

Article Snippet: Pathogenic microorganisms used in the present study were Gram-negative bacteria including MDR isolates (Laboratory collection) and reference strains (American Type Culture Collection) of Escherichia coli (ATCC8739, ATCC10536, AG100, AG100A, AG100ATet, AG102, MC4100 W3110), Enterobacter aerogenes (ATCC13048, CM64, EA27, EA289, EA298, EA294), Klebsiella pneumoniae (ATCC11296, KP55, KP63, K24, K2), Enterobacter cloacae (ECCI69, BM47, BM67), Pseudomonas aeruginosa (PA01, PA124) and Providencia stuartii (ATCC29916, NEA16, PS2636, PS299645).

Techniques: Sterility, Activity Assay, Control, Infection

Effect of sub-inhibitory concentrations of Anthocleista schweinfurthii fruits extract on the activities of first line antibiotics against Gram-negative MDR bacteria

Journal: BMC Complementary and Alternative Medicine

Article Title: Antibacterial and antibiotic-modulation activity of six Cameroonian medicinal plants against Gram-negative multi-drug resistant phenotypes

doi: 10.1186/s12906-016-1105-1

Figure Lengend Snippet: Effect of sub-inhibitory concentrations of Anthocleista schweinfurthii fruits extract on the activities of first line antibiotics against Gram-negative MDR bacteria

Article Snippet: Pathogenic microorganisms used in the present study were Gram-negative bacteria including MDR isolates (Laboratory collection) and reference strains (American Type Culture Collection) of Escherichia coli (ATCC8739, ATCC10536, AG100, AG100A, AG100ATet, AG102, MC4100 W3110), Enterobacter aerogenes (ATCC13048, CM64, EA27, EA289, EA298, EA294), Klebsiella pneumoniae (ATCC11296, KP55, KP63, K24, K2), Enterobacter cloacae (ECCI69, BM47, BM67), Pseudomonas aeruginosa (PA01, PA124) and Providencia stuartii (ATCC29916, NEA16, PS2636, PS299645).

Techniques:

Effect of sub-inhibitory concentrations of Nauclea latifolia leaves extract on the activities of first line antibiotics against Gram-negative MDR bacteria

Journal: BMC Complementary and Alternative Medicine

Article Title: Antibacterial and antibiotic-modulation activity of six Cameroonian medicinal plants against Gram-negative multi-drug resistant phenotypes

doi: 10.1186/s12906-016-1105-1

Figure Lengend Snippet: Effect of sub-inhibitory concentrations of Nauclea latifolia leaves extract on the activities of first line antibiotics against Gram-negative MDR bacteria

Article Snippet: Pathogenic microorganisms used in the present study were Gram-negative bacteria including MDR isolates (Laboratory collection) and reference strains (American Type Culture Collection) of Escherichia coli (ATCC8739, ATCC10536, AG100, AG100A, AG100ATet, AG102, MC4100 W3110), Enterobacter aerogenes (ATCC13048, CM64, EA27, EA289, EA298, EA294), Klebsiella pneumoniae (ATCC11296, KP55, KP63, K24, K2), Enterobacter cloacae (ECCI69, BM47, BM67), Pseudomonas aeruginosa (PA01, PA124) and Providencia stuartii (ATCC29916, NEA16, PS2636, PS299645).

Techniques:

Effect of sub-inhibitory concentrations of Zehneria scobra extract on the activities of first line antibiotics against Gram-negative MDR bacteria

Journal: BMC Complementary and Alternative Medicine

Article Title: Antibacterial and antibiotic-modulation activity of six Cameroonian medicinal plants against Gram-negative multi-drug resistant phenotypes

doi: 10.1186/s12906-016-1105-1

Figure Lengend Snippet: Effect of sub-inhibitory concentrations of Zehneria scobra extract on the activities of first line antibiotics against Gram-negative MDR bacteria

Article Snippet: Pathogenic microorganisms used in the present study were Gram-negative bacteria including MDR isolates (Laboratory collection) and reference strains (American Type Culture Collection) of Escherichia coli (ATCC8739, ATCC10536, AG100, AG100A, AG100ATet, AG102, MC4100 W3110), Enterobacter aerogenes (ATCC13048, CM64, EA27, EA289, EA298, EA294), Klebsiella pneumoniae (ATCC11296, KP55, KP63, K24, K2), Enterobacter cloacae (ECCI69, BM47, BM67), Pseudomonas aeruginosa (PA01, PA124) and Providencia stuartii (ATCC29916, NEA16, PS2636, PS299645).

Techniques:

Effect of sub-inhibitory concentrations of Nauclea latifolia stem bark extract on the activities of first line antibiotics against Gram-negative MDR bacteria

Journal: BMC Complementary and Alternative Medicine

Article Title: Antibacterial and antibiotic-modulation activity of six Cameroonian medicinal plants against Gram-negative multi-drug resistant phenotypes

doi: 10.1186/s12906-016-1105-1

Figure Lengend Snippet: Effect of sub-inhibitory concentrations of Nauclea latifolia stem bark extract on the activities of first line antibiotics against Gram-negative MDR bacteria

Article Snippet: Pathogenic microorganisms used in the present study were Gram-negative bacteria including MDR isolates (Laboratory collection) and reference strains (American Type Culture Collection) of Escherichia coli (ATCC8739, ATCC10536, AG100, AG100A, AG100ATet, AG102, MC4100 W3110), Enterobacter aerogenes (ATCC13048, CM64, EA27, EA289, EA298, EA294), Klebsiella pneumoniae (ATCC11296, KP55, KP63, K24, K2), Enterobacter cloacae (ECCI69, BM47, BM67), Pseudomonas aeruginosa (PA01, PA124) and Providencia stuartii (ATCC29916, NEA16, PS2636, PS299645).

Techniques: